# bedjs

> Manage BED (Browser Extensible Data) files with Node.JS (Bioinformatics)

Latest version **1.0.3** (published 2016-12-06) · MIT license · 0 weekly downloads

## Install

```sh
npm install bedjs
pnpm add bedjs
yarn add bedjs
bun add bedjs
```

## Health

**Score 15/100 (F)** — status: abandoned.

Positive: no vulnerabilities.

Warnings: low downloads; no types; no esm support.

Negative: abandoned; low maintenance score.

## Facts

| | |
|---|---|
| Version | 1.0.3 |
| Published | 2016-12-06 |
| First published | 2016-01-07 |
| Weekly downloads | 0 |
| License | MIT |
| TypeScript types | none |
| Module format | CommonJS |
| Dependencies | 2 |
| Known vulnerabilities | 0 |
| Install scripts | no |
| GitHub stars | 1 |
| Author | Josemi Juanes |
| Maintainers | jmjuanes |
| Keywords | bioinformatics, bed, genomic, genome |

## Links

- npm: https://www.npmjs.com/package/bedjs
- Repository: https://github.com/jmjuanes/bedjs
- Issues: https://github.com/jmjuanes/bedjs/issues
- npm.io page: https://npm.io/package/bedjs

## Dependencies (2)

- [pstat](https://npm.io/package/pstat.md) 1.0.2
- [readl](https://npm.io/package/readl.md) 0.0.8

## Alternatives

- [mobx-react](https://npm.io/package/mobx-react.md) — 2.8M weekly downloads
- [rc-tree](https://npm.io/package/rc-tree.md) — 2.6M weekly downloads
- [@react-oauth/google](https://npm.io/package/@react-oauth/google.md) — 1.3M weekly downloads
- [@wagmi/connectors](https://npm.io/package/@wagmi/connectors.md) — 877.0K weekly downloads
- [vee-validate](https://npm.io/package/vee-validate.md) — 836.4K weekly downloads

## Recent versions

- 1.0.3 (latest) — 2016-12-06
- 1.0.2 — 2016-08-09
- 1.0.1 — 2016-06-12
- 1.0.0 — 2016-05-31
- 0.1.0 — 2016-01-07

## README

# bedJS

[![npm](https://img.shields.io/npm/v/bedjs.svg?style=flat-square)](https://www.npmjs.com/package/bedjs)
[![npm](https://img.shields.io/npm/dt/bedjs.svg?style=flat-square)](https://www.npmjs.com/package/bedjs)

Manage BED (Browser Extensible Data) files with Node.JS (Bioinformatics).

## Install

Use NPM to install the package:

```
npm install bedjs
```

## Overview

### About the BED file format

A BED file is a tab delimited containing one feature of interest per line. Each line must contain at least the three first fields listed below:

| KEY | Description | Type |
|-----|-------------|------|
| chromosome | Chromosome name | String |
| start | Start position of the feature | Integer |
| end | End position of the feature | Integer |
| name | Name of the line | String |
| score | Score between 0 and 1000 | Integer |
| strand | Strand of the feature ('+' or '-') | String |
| thickStart | Start position at which the feature is drawn thickly | Integer |
| thickEnd | End position at which the feature is drawn thickly | Integer |
| itemRgb | RGB value in format R,G,B | String |
| blockCount | The number of blocks (exons) in the BED line | Integer |
| blockSizes | A comma-separated list of the block sizes | String |
| blockStarts | A comma-separated list of block starts | String |

You can read more about the BED format [here](http://Mar2016.archive.ensembl.org/info/website/upload/bed.html).

### The BED object

This tool will convert each line of a BED file in one JavaScript object, where each column of the BED file will be saved with the format `key=value`. The `key` attribute will be one of the previous table.

Example of a BED file:

```
1	6579260	6579725	PLEKHG5
1	10292069	10292214	KIF1B
1	33282660	33282997	YARS
1	156084621	156085204	LMNA
```

The previous BED file converted to a BED object will be:

```javascript
[
  { chromosome: '1', start: 6579260, end: 6579725, name: 'PLEKHG5' },
  { chromosome: '1', start: 10292069, end: 10292214, name: 'KIF1B' },
  { chromosome: '1', start: 33282660, end: 33282997, name: 'YARS' },
  { chromosome: '1', start: 156084621, end: 156085204, name: 'LMNA' }
]
```

## API

Include the package in your JavaScript code using:

```javascript
var bedJS = require('bedjs');
```

### bedJS.Read(file)

Read a BED file. Returns an array with one BED object for each line of the BED file.

```javascript
var bed = bedJS.Read('example.bed');
```

### bedJS.Write(file, bed)

Save an array with BED objects to a BED file.

```javascript
bedJS.Write('newfile.bed', bed);
```

### bedJS.Collapse

A class to combine all BED objects into a new object. The following combining methods are available:

#### bedJS.Collapse.ByRegion(bed)

Combines all BED objects with overlapping features into a new BED object. This method only combines all features that have the same chromosome and the same strand.

Example of a BED object:

```javascript
[
  { "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 550, "end": 700, "name": "REGION2", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
```

If now we run:

```javascript
var bed2 = bedJS.Collapse.ByRegion(bed);
```

This will return the following array:

```javascript
[
  { "chromosome": "2", "start": 500, "end": 700, "name": "REGION1,REGION2", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
```

#### bedJS.Collapse.ByName(bed)

Combines all BED objects that have the same feature `name`. The output object will have the minimum start position and the maximum end position of all objects combined.

Example of a BED object:

```javascript
[
  { "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 700, "end": 800, "name": "REGION1", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 500, "end": 700, "name": "REGION2", "score": 0, "strand": "-" }
]
```

If now we run:

```javascript
var bed2 = bedJS.Collapse.ByName(bed);
```

This will return the following array:

```javascript
[
  { "chromosome": "2", "start": 500, "end": 800, "name": "REGION1", "score": 0, "strand": "+" },
  { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" }
]
```

### bedJS.Fasta

A set of tools to work with Fasta files.

#### bedJS.Fasta.Index(file)

Create an index of your Fasta file in JSON format. This index is required if you want to use the `bedJS.Fasta.Get` function.

```javascript
bedJS.Fasta.Index('fasta_file.fa');
```

The previous command will generate a file called `fasta_file.fa.json`. Once you have created the index file, you don't need to run it again.

#### bedJS.Fasta.Get(fasta, bed, opt)

A method to extract sequences from a Fasta file using the regions delimited in your BED file or in your BED object. The inputs of this method are:

- `fasta`: the path of your fasta file where you will extract the sequence.
- `bed`: a BED object or the path to a BED file with the regions where you want to extract the sequence.
- `opt`: an object with the following keys:
  - `strand`: set it to `true` if you want to extract the sequence with the same orientation defined in the BED file. Default is `false`.

This will return an array with the sequence for each BED object.

Note that you must run `bedJS.Fasta.Index` to index the Fasta file before run this function.

Example of a Fasta file:
```
test.fa:
>1
ACTGAAAAACCCGGTTTAACGTACCGG
```

Example of a bed file
```
test.bed:
1 5 10
```

If you run:

```javascript
var sequence = bedJS.Fasta.Get('test.fa', 'test.bed', { strand: false });

// -> sequence = [ { "head": "1:5-10", "sequence": "AAAAC"}] 
```

## License

© [MIT LICENSE](./LICENSE) Jose M. Juanes.

---
_Source: https://npm.io/package/bedjs · Machine-readable twin of the npm.io package page. Health data is recomputed on every publish._