@datagrok/sequence-translator NPM

Sequence Translator

SequenceTranslator is a package for the Datagrok platform, used to translate oligonucleotide sequences between different representations .

Presentation: https://www.youtube.com/watch?v=2xuxJjpjXi4&t=3783s

Oligonucleotides are characterized by the sequence of nucleotide modifications that make up the entire molecule. The length of the oligonucleotide is usually 13-25 nucleotides long (denoted by " -mer").

Oligonucleotides are chemically synthesized. Chain assembly proceeds in the 3' to 5' direction by following a routine procedure referred to as a "synthetic cycle". Completion of a single synthetic cycle results in the addition of one nucleotide residue to the growing chain.

Use cases

Name	Steps
Translate one sequence of types list	Paste sequence into the text field in `MAIN` tab of App
Translate many sequences of types list	1. Open SequenceTranslator 2. Drag & drop an Excel or CSV file with sequences into Datagrok. The platform will detect columns with sequences if they match corresponding RegExp rules 3. Right-click on the column header, then see the `Convert` menu 4. Choose translation function This will add the result column to the right of the table
Translate sequences using new Axolabs pattern	1. Go to `AXOLABS` tab 2. Drag & drop an Excel or CSV file with sequences into Datagrok 3. Choose your table in the `Table` field 4. Choose `SS Column`, and, if needed, `AS Column` and `ID Column`(needed to add column with concatenated ID and pattern name) 5. Press `Convert Sequences` button This will add the result column(s) to the right of the table. Save pattern, if needed
Translate sequences using existing Axolabs pattern	1. Go to `AXOLABS` tab 2. Select your pattern in `Load Pattern` field 3. Do steps #2-5 from previous use case

Sequence representations

In the modification section on the right side of the screen you can select modification for each base in your input sequence and check if PTO after the base is required.

Representations are splitted into categories by synthesizer's sequence format(BioSpring/Axolabs/MerMade) and type of molecule (Gapmers / siRNA).

Name	Example	Regular expression
DNA nucleotides	`AGGTCTTCATGACTTCGGCC`	`^[ATGC]{10,}$`
RNA nucleotides	`UUCAACUGCUUACGUCUUU`	`^[AUGC]{10,}$`
BioSpring / Gapmers	`68857TT9ATGA9TT7887*7`	`^[*56789ATGC]{30,}$`
GCRS / Gapmers	`moeAnpsmoeGnpsmoeGnpsmoeUnpsmoe5mCnpsTpsTpsCpsApsTpsGpsApsCpsTpsTpsmoe5mCnpsmoeGnpsmoeGnpsmoe5mCnpsmoe5mC`	`^(?=.moe)(?=.5mC)(?=.*ps){30,}`
BioSpring / siRNA	`5176635471527457555`	`^[*1-8]{30,}$`
Axolabs / siRNA	`usUfscaaCfuGfcUfuAfcGfucususu`	`^[fsACGUacgu]{20,}$`
GCRS	`mUpsfUpsmCmAmAfCmUfGmCfUmUfAmCfGmUmCmUpsmUpsmU`	`^[fmpsACGU]{30,}$`
OP100	`ugaauuagaggagacgga*cac`	`^[acgu*]{10,}$`
MerMade (MM)	`kgKHKGLHIELGJFHKiehK`	`^[IiJjKkLlEeFfGgHhQq]{10,}$`
Applied Biosystems Inc. (ABI)	`58877TTTACCACGT56788`	`^[5678ATGC]{10,}$`

Axolabs nucleotide modifications

Name	Description	Symbols
`RNA`	RNA nucleotides	`A, C, G, U`
`DNA`	DNA nucleotides	`dA, dC, dG, dT`
`2'-Fluoro`	2'-Fluoro nucleotides	`Af, Cf, Gf, Uf`
`2'-O-Methyl`	2'-O-Methyl nucleotides	`a, c, g, u`
`2'-O-MOE`	2'-O-MOE nucleotides (including 5-Methyl C)	`Am, Cm, Gm, Tm`
`GNA`	Glycol nucleic acid	`(GNA-A), (GNA-C), (GNA-G), (GNA-T)`
`LNA`	Locked nucleic acid (including 5-Methyl C)	`Ab, Cb, Gb, Tb`
`UNA`	Unlocked nucleotides	`Ao, Co, Go, Uo`
`A`	Adenine	`a`
`C`	Cytosine	`c`
`G`	Guanine	`g`
`U`	Uracil	`u`
`X-New`		`X`
`Y-New`		`Y`
`Z-New`		`Z`
`InvAbasic`	Inverted abasic capped	`(invabasic)`
`5'-vinylps`	5'-vinylphosphonate-2'-OMe-uridine	`(vinu)`
`InvAbasic(o)`	Inverted abasic capped (overhang)	`(invabasic)`
`2'-OMe-U(o)`	Nucleotide Uridine with 2’O-Methyl protection (overhang)	`mU`

App glossary

Term	Definition
Pattern	Defines translation rules. Contains: pattern name, modifications and PTO linkages for both strands, and comment, displayed on image
PTO linkage	Indicates whether oligonucleotide has phosphorothioated bond (ps linkage) after the base
Sense strand (SS)	Contains the exact nucleotide sequence to the mRNA which encodes for a functional protein. Has the information that would be readable on the RNA, and that's called the coding side.
Antisense strand (AS)	Non-coding DNA strand of a gene. A cell uses antisense DNA strand as a template for producing messenger RNA (mRNA) that directs the synthesis of a protein.