@lipme/omique-utils-pipeline v0.1.14

Omique Utils Pipeline

A utility pipeline for transforming genomic data, designed for bioinformatics applications.

Table of Contents

• Installation
• Usage
  • Examples
• Running Tests
• Building Locally
• Contributing
• License

Installation

To install the package, use npm:

npm install @lipme/omique-utils-pipeline

Usage

This library provides utilities for working with genomic data, including BAM and GFF3 file processing.

Examples

1. Setting BAM Levels

import { setBamsLevels } from "@lipme/omique-utils-pipeline";

const bams = [
  { start: 1, end: 3 },
  { start: 2, end: 4 },
  { start: 3, end: 5 },
];

const leveledBams = setBamsLevels(bams);
console.log(leveledBams);

2. Extracting CIGAR Information

import { cigarExtraction } from "@lipme/omique-utils-pipeline";

const bamData = [{ start: 1, end: 100, cigar: "10M5I5D" }];

const extractedCigar = cigarExtraction(bamData);
console.log(extractedCigar);

3. Parsing MD Tags

import { extractMD } from "@lipme/omique-utils-pipeline";

const bamLines = [
  {
    MD: "10A5^C3",
    seq: "ACGTACGTACGTACGTACGT",
    start: 1,
    end: 20,
    strand: "+",
  },
];

const mdData = extractMD(bamLines);
console.log(mdData);

4. Assigning GFF Levels

import { RowNumberFactory } from "@lipme/omique-utils-pipeline";

const features = [
  { start: 1, end: 100 },
  { start: 50, end: 150 },
];

const rowFactory = RowNumberFactory(features);
const leveledFeatures = features.map(rowFactory);
console.log(leveledFeatures);

Running Tests

To run the test suite, use:

npm test

For test coverage:

npm run test:coverage

To watch tests during development:

npm run test:watch

Building Locally

To build the project locally:

1. Clone the repository:

   git clone https://github.com/your-repo/omique-utils-pipeline.git
   cd omique-utils-pipeline

2. Install dependencies:

   npm install

3. Build the project:

   npm run build

The output will be available in the dist directory.

Contributing

Contributions are welcome! Please follow these steps:

1. Fork the repository.
2. Create a new branch for your feature or bugfix.
3. Commit your changes and push the branch.
4. Open a pull request.

License

This project is licensed under the ISC License. See the LICENSE file for details.