@mmsb/result_page v3.4.0
Table of sgRNA with radial representation

Usage
Need property to launch integrated components. So need complete_data to create the table-crispr component to the left side and alL_data, org_names and potentially gene to create genomic-card component.
If the gene property is given, then the linear-card component is created when the user click on a sector on the sunburst.
complete_data
A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : +-\(0-9*,0-9*\)
[
{
"sequence": "AAAACTCAAATGAATTGACGGGG",
"occurences": [
{
"org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
"all_ref": [
{
"ref": "NC_015662.1",
"coords": [
"-(195725,195747)"
]
}
]
},
{
"org": "Aliivibrio wodanis GCF_000953695.1",
"all_ref": [
{
"ref": "NZ_LN554846.1",
"coords": [
"+(2675080,2675102)",
"+(2862314,2862336)",
"+(2959996,2960018)",
"-(507284,507306)",
"-(559657,559679)",
"-(661047,661069)"
]
},
{
"ref": "NZ_LN554847.1",
"coords": [
"+(894485,894507)"
]
}
]
}
]
}
]all_data
A dictionary of organisms selected in JSON format with their referencesn sgRNA on them and their coordinates which must match the regex : +-\(0-9*,0-9*\)
{
"Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1":
{"NC_015662.1":
{"AAAACTCAAATGAATTGACGGGG":
["-(195725,195747)"],
"AAACTCAAATGAATTGACGGGGG":
["-(195726,195748)"],
"TCCCCACTGCTGCCTCCCGTAGG":
["+(506719,506741)", "+(559092,559114)", "+(660482,660504)", "-(2675645,2675667)", "-(2862879,2862901)", "-(2960561,2960583)"]
}
},
"Aliivibrio wodanis GCF_000953695.1":
{"NZ_LN554846.1":
{"AAAACTCAAATGAATTGACGGGG":
["+(2675080,2675102)", "+(2862314,2862336)", "+(2959996,2960018)", "-(507284,507306)", "-(559657,559679)", "-(661047,661069)"]
},
"NZ_LN554847.1":
{"AAAACTCAAATGAATTGACGGGG":
["+(894485,894507)"]
}
}
}org_names
A string of organisms names selected seperated by "&".
"Enterobacter sp. 638 GCF_000016325.1&Candidatus Blochmannia vafer str. BVAF GCF_000185985.2"size
If no precise, all size are set to 4,518,734.
{
"Enterobacter sp. 638 GCF_000016325.1":
{"NC_009436.1":100000},
"Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
{"NC_014909.2": 2000000}}gene
A dictionary object with organisms as keys and their references. Then, a list of dictionary with start and end keys to indicate coordinates of gene.
{
"Enterobacter sp. 638 GCF_000016325.1":
{"NC_009436.1":
[{"start": "255180", "end": "255599"}, {"start": "842680", "end": "843099"}, {"start": "3343077", "end": "3343496"}, {"start": "4024310", "end": "4024729"}, {"start": "4269724", "end": "4270143"}, {"start": "4360796", "end": "4361215"}, {"start": "4466539", "end": "4466958"}]
},
"Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
{"NC_014909.2":
[{"start": "626246", "end": "626664"}]
}
}Event
***** GENOMIC-CARD *****
Emit
changeOrgCard : sent the name of the organism selected
changeRefCard : sent the reference selected
changeSgrnaCard : sent the sgRNA selected
sgDataSection : sent : allSgrna --> dictionary of sgRNA with their coordinates in a list gene --> a list of dictionary containing start and stop for genes
Send
changeOrgCard : change the organism selected, find data associated to this organism and create a new representation
changeRefCard : change the reference selected, find data associated and create a new representation
changeSgrnaCard : represent sgRNA selected by a red vertical line around the circle
changeOrgRefSgrna : find name of the organism name and its reference in axis key and sgRNA selected in sgrna key. Find data associated and create a new representation
Authors
Sophie LEMATRE
Date
July 22 2019
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago