@mmsb/table-crispr v2.1.0
Table of sgRNA with radial representation

Usage
Need only one property : complete_data Another component will be installed : radial-crispr to create the radial representation inside table.
You can search a sgRNA by a regex or by a minimun occurence.
complete_data
A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : +-\(0-9*,0-9*\)
[
{
"sequence": "AAAACTCAAATGAATTGACGGGG",
"occurences": [
{
"org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
"all_ref": [
{
"ref": "NC_015662.1",
"coords": [
"-(195725,195747)"
]
}
]
},
{
"org": "Aliivibrio wodanis GCF_000953695.1",
"all_ref": [
{
"ref": "NZ_LN554846.1",
"coords": [
"+(2675080,2675102)",
"+(2862314,2862336)",
"+(2959996,2960018)",
"-(507284,507306)",
"-(559657,559679)",
"-(661047,661069)"
]
},
{
"ref": "NZ_LN554847.1",
"coords": [
"+(894485,894507)"
]
}
]
}
]
}
]Event
None
Authors
Sophie LEMATRE
Date
July 18 2019
6 years ago
6 years ago
6 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago