@mmsb/table-crispr NPM

Table of sgRNA with radial representation

example display

Usage

Need only one property : complete_data Another component will be installed : radial-crispr to create the radial representation inside table.

You can search a sgRNA by a regex or by a minimun occurence.

complete_data

A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : +-\(0-9*,0-9*\)

[
    {
        "sequence": "AAAACTCAAATGAATTGACGGGG",
        "occurences": [
            {
                "org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
                "all_ref": [
                    {
                        "ref": "NC_015662.1",
                        "coords": [
                            "-(195725,195747)"
                        ]
                    }
                ]
            },
            {
                "org": "Aliivibrio wodanis GCF_000953695.1",
                "all_ref": [
                    {
                        "ref": "NZ_LN554846.1",
                        "coords": [
                            "+(2675080,2675102)",
                            "+(2862314,2862336)",
                            "+(2959996,2960018)",
                            "-(507284,507306)",
                            "-(559657,559679)",
                            "-(661047,661069)"
                        ]
                    },
                    {
                        "ref": "NZ_LN554847.1",
                        "coords": [
                            "+(894485,894507)"
                        ]
                    }
                ]
            }
        ]
    }
]