0.0.4 • Published 12 years ago
blast-wrapper v0.0.4
blast-wrapper
blast-wrapper is a a node.js web-service wrapper for old BLAST executables (not BLAST+), specifically bl2seq.
In theory this should be faster than a CGI wrapper.
I use this for aligning sequences to the mitochondrial genome using bl2seq but it could be modified to use blastall with a few tweaks.
A mitochondrial BLAST index and a sample config file are provided.
Usage
From github:
git clone git@github.com:leipzig/blast-wrapper.git
cd blast-wrapper
npm start
From npm:
npm install blast-wrapper
npm blast-wrapper start
To access:
http://localhost:8080/?name=mysequence&seq=TGGTCAACCTCGACCTAGGCCTCCTATTTATTCTAGCCACCG
Result:
Query= mysequence
(42 letters)
>gi|251831106|ref|NC_012920.1| Homo sapiens mitochondrion, complete
genome
Length = 16569
Score = 71.3 bits (38), Expect = 2e-16
Identities = 40/41 (97%)
Strand = Plus / Plus
Query: 1 tggtcaacctcgacctaggcctcctatttattctagccacc 41
||||||||||| |||||||||||||||||||||||||||||
Sbjct: 3590 tggtcaacctcaacctaggcctcctatttattctagccacc 3630
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 2.5
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 1.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 42
Length of database: 16,569
Length adjustment: 12
Effective length of query: 30
Effective length of database: 16,557
Effective search space: 496710
Effective search space used: 496710
X1: 11 (21.1 bits)
X2: 27 (49.9 bits)
X3: 54 (99.7 bits)
S1: 10 (19.9 bits)
S2: 10 (19.6 bits)