3.7.15 • Published 2 years ago

seqviz-dlw v3.7.15

Weekly downloads
-
License
MIT
Repository
github
Last release
2 years ago

SeqViz is a DNA, RNA, and protein sequence viewer.

Used By

Table of Contents

Demo

You can see a demo at tools.latticeautomation.com/seqviz. The source is in /demo.

Features

Linear and Circular Sequence Viewer

  • Annotations with names and colors
  • Amino acid translations
  • Enzyme cut sites
  • Searching with mismatches and highlighting

Sequence and Element Selection

  • Selecting a range on the viewer(s), or clicking an annotation, translation, cutSite or searchResult, will highlight the selection and pass it to the onSelection() callback.

Usage

Installation

npm

npm install seqviz

CDN

<script src="https://unpkg.com/seqviz"></script>

Instantiation

React

import { SeqViz } from "seqviz";

export default () => (
  <SeqViz
    name="J23100"
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC"
    annotations={[{ name: "promoter", start: 0, end: 34, direction: 1, color: "blue" }]}
  />
);

Non-React

More details are in the Viewer without React section.

<script>
  window.seqviz
    .Viewer("root", {
      name: "L09136",
      seq: "tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgca",
      style: { height: "100vh", width: "100vw" },
    })
    .render();
</script>

Props

All the following are usable as props for the React component (seqviz.SeqViz) or as options for the plain JS implementation (seqviz.Viewer()).

Required

seq (='')

A sequence to render. Can be a DNA, RNA, or amino acid sequence.

File or Accession

These props are @deprecated and may be removed in a future major release. We recommend parsing sequence files outside of SeqViz with the seqparse package.

  • file is a FASTA, GenBank, SnapGene, JBEI, or SBOL file (string | File)
  • accession is an NCBI accession-ID (string)

For example:

import seqparse from "seqparse";

export default () => {
  const [seq, setSeq] = useState({ name: "", seq: "", annotations: [] });

  // fetch and parse a sequence from NCBI: https://www.ncbi.nlm.nih.gov/nuccore/MN623123.1
  useEffect(async () => setSeq(await seqparse("MN623123.1")));

  return <SeqViz name={seq.name} seq={seq.seq} annotations={seq.annotations} />;
};

Optional

viewer (='both')

The type and orientation of the sequence viewers. One of "linear" | "circular" | "both" | "both_flip". both means the circular viewer fills the left side of SeqViz, and the linear viewer fills the right. both_flip is the opposite: the linear viewer is on the left, and the circular viewer is on the right.

name (='')

The name of the sequence/plasmid. Shown at the center of the circular viewer.

annotations (=[])

An array of Annotations to render. Each Annotation requires 0-based start (inclusive) and end (exclusive) indexes. names are rendered on top of the annotations. Set the annotation's direction to 1 for forward arrows and -1 for reverse arrows.

annotations = [
  { start: 0, end: 22, name: "Strong promoter", direction: 1 }, // [0, 22)
  { start: 23, end: 273, name: "GFP" },
  { start: 300, end: 325, name: "Weak promoter", direction: -1, color: "#FAA887" },
];

In the example above, the "Strong promoter" would span the first to twenty-second base pair.

translations (=[])

An array of translations: sequence ranges to translate and render as amino acids sequences. Requires 0-based start (inclusive) and end (exclusive) indexes relative the DNA sequence. A direction is required: 1 (FWD) or -1 (REV).

translations = [
  { start: 0, end: 90, direction: 1 }, // [0, 90)
  { start: 191, end: 522, direction: -1 },
];

enzymes (=[])

An array of restriction enzymes to show recognition sites for. A list of pre-defined enzymes in src/enzymes.ts can be referenced by name. Example:

enzymes = [
  "EcoRI",
  "PstI",
  {
    name: "Cas9",
    rseq: "NGG", // recognition sequence
    fcut: 0, // cut index on FWD strand, relative to start of rseq
    rcut: 1, // cut index on REV strand, relative to start of rseq
    color: "#D7E5F0", // color to highlight recognition site with
    // (optional) only show recognition sites between 100th and 250th index [100, 250)
    range: {
      start: 100,
      end: 250,
    },
  },
];

highlights (=[])

Ranges of sequence to highlight. A default color from colors is used if none is provided.

highlights = [
  { start: 36, end: 66, color: "magenta" },
  { start: 70, end: 80 },
];

zoom (={ linear: 50 })

How zoomed the viewer(s) should be 0-100. Key'ed by viewer type, but only linear is supported.

colors (=[])

An array of colors to use for annotations, translations, and highlights. Defaults are in src/colors.ts.

bpColors (={})

An object mapping base pairs to their color. The key/bp is either a nucleotide type or 0-based index. Example:

bpColors = { A: "#FF0000", T: "blue", 12: "#00FFFF" };

style (={})

Style for seqviz's outer container div. Empty by default. Useful for setting the height and width of the viewer if the element around seqviz lacks one. For example:

style = { height: "100vh", width: "100vw" };

selection (={})

This (optional) selection prop is useful if you want to externally manage and set the selection state:

selection = {
  start: 133,
  end: 457,
  clockwise: true,
};

onSelection (=(_: Selection) => {})

A callback executed after selection events. It accepts a single Selection type argument.

This occurs after drag/drop selections and clicks. It will have meta on annotation, translation, enzyme, highlight or search elements if one was selected. The example below shows an annotation selection:

{
  "end": 457,
  "length": 324,
  "name": "lacZ fragment",
  "start": 133,
  "type": "ANNOTATION",
}

search (={})

Sequence search parameters. Takes a query sequence and the maximum allowable mismatch for a match (default: 0). Matches are highlighted.

search = { query: "aatggtctc", mismatch: 1 };

Searching supports wildcard symbols, e.g. { query: "AANAA" }. All symbols supported are in src/sequence.ts.

onSearch (=(_: Range) => {})

A callback executed after a search event. This is called once on initial render and every time the sequence changes thereafter. An example of search results is below:

[
  {
    start: 728,
    end: 733,
    direction: 1,
    index: 0,
  },
  {
    start: 1788,
    end: 1793,
    direction: -1,
    index: 1,
  },
];

copyEvent (=(e: KeyboardEvent) => e.key === "c" && (e.metaKey || e.ctrlKey))

A function returning whether to copy the viewer(s) current selection during a keyboard event. The default method copies sequence after any ctrl+c or meta+c keyboard events.

showComplement (=true)

Whether to show the complement sequence.

rotateOnScroll (=true)

By default, the circular viewer rotates when scrolling over the viewer. That can be disabled with rotateOnScroll: false.

Without React

For usability in non-React apps, we provide a thin wrapper around the React component. The viewer's constructor accepts two arguments:

const element = document.getElementById("root");
const viewer = seqviz.Viewer(element, props);
// Render the viewer to the DOM at the node passed in $element`.
viewer.render();
// To later update the viewer's configuration and re-renders.
viewer.setState(props);
// To render the viewer, eg for server-side rendering, and returns it as an HTML string.
viewer.renderToString();

Contact Us

This library is maintained by Lattice Automation.

You can report bugs and request features at Issues or contact us directly at contact@latticeautomation.com