bio-parsers v9.3.6
Bio Parsers
- Bio Parsers
About this Repo
This repo contains a set of parsers to convert between datatypes through a generalized JSON format.
CHANGELOG
Exported Functions
Use the following exports to convert to a generalized JSON format:
fastaToJson //handles fasta files (.fa, .fasta)
genbankToJson //handles genbank files (.gb, .gbk)
ab1ToJson //handles .ab1 sequencing read files
sbolXmlToJson //handles .sbol files
geneiousXmlToJson //handles .genious files
jbeiXmlToJson //handles jbei .seq or .xml files
snapgeneToJson //handles snapgene (.dna) files
anyToJson //this handles any of the above file types based on file extensionUse the following exports to convert from a generalized JSON format back to a specific format:
jsonToGenbank
jsonToFasta
jsonToBedFormat Specification
The generalized JSON format looks like:
const generalizedJsonFormat = {
"size": 25,
"sequence": "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
"circular": true,
"name": "pBbS8c-RFP",
"description": "",
"parts": [
{
"name": "part 1",
"type": "CDS", //optional for parts
"id": "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 10, //0-based inclusive index
"end": 30, //0-based inclusive index
"strand": 1,
"notes": {},
}
],
"primers": [
{
"name": "primer 1",
"id": "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 10, //0-based inclusive index
"end": 30, //0-based inclusive index
"strand": 1,
"notes": {},
}
],
"features": [
{
"name": "anonymous feature",
"type": "misc_feature",
"id": "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
"start": 1,
"end": 3,
"strand": 1,
"notes": {},
},
{
"name": "coding region 1",
"type": "CDS",
"id": "5590c1d88979df000a4f02f5",
"start": 12,
"end": 9,
"strand": -1,
"notes": {},
}
],
//only if parsing in an ab1 file
"chromatogramData": {
"aTrace": [], //same as cTrace but for a
"tTrace": [], //same as cTrace but for t
"gTrace": [], //same as cTrace but for g
"cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
"basePos": [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced)
"baseCalls": ["A", "T", ...etc],
"qualNums": [], //or undefined if no qualNums are detected on the file
},
}Usage
install
npm install -S bio-parsers
or
yarn add bio-parsers
or
use it from a script tag:
<script src="https://unpkg.com/bio-parsers/umd/bio-parsers.js"></script>
<script>
async function main() {
var jsonOutput = await window.bioParsers.genbankToJson(
`LOCUS kc2 108 bp DNA linear 01-NOV-2016
COMMENT teselagen_unique_id: 581929a7bc6d3e00ac7394e8
FEATURES Location/Qualifiers
CDS 1..108
/label="GFPuv"
misc_feature 61..108
/label="gly_ser_linker"
bogus_dude 4..60
/label="ccmN_sig_pep"
misc_feature 4..60
/label="ccmN_nterm_sig_pep"
/pragma="Teselagen_Part"
/preferred5PrimeOverhangs=""
/preferred3PrimeOverhangs=""
ORIGIN
1 atgaaggtct acggcaagga acagtttttg cggatgcgcc agagcatgtt ccccgatcgc
61 ggtggcagtg gtagcgggag ctcgggtggc tcaggctctg ggg
//`
);
console.log('jsonOutput:', jsonOutput);
var genbankString = window.bioParsers.jsonToGenbank(jsonOutput[0].parsedSequence);
console.log(genbankString);
}
main();
</script>see the ./umd_demo.html file for a full working example
jsonToGenbank (same interface as jsonToFasta)
//To go from json to genbank:
import { jsonToGenbank } from "bio-parsers"
//You can pass an optional options object as the second argument. Here are the defaults
const options = {
isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true)
guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag)
guessIfProteinOptions: {
threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA
dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA
},
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
// Example:
// 0123456
// ATGAGAG
// --fff-- (the feature covers GAG)
// 0-based inclusive start:
// feature.start = 2
// 1-based inclusive start:
// feature.start = 3
// 0-based inclusive end:
// feature.end = 4
// 1-based inclusive end:
// feature.end = 5
}
const genbankString = jsonToGenbank(generalizedJsonFormat, options)anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)
import { anyToJson } from "bio-parsers"
//note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed)
const results = await anyToJson(
stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
)
//we always return an array of results because some files my contain multiple sequences
results[0].success //either true or false
results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData Options (for anyToJson or xxxxToJson)
//You can pass an optional options object as the third argument. Here are the defaults
const options = {
fileName: "example.gb", //the filename is used if none is found in the genbank
isProtein: false, //if you know that it is a protein string being parsed you can pass true here
parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true
//genbankToJson options only
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead
// fastaToJson options only
parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description
}ab1ToJson
import { ab1ToJson } from "bio-parsers"
const results = await ab1ToJson(
//this can be either a browser file <input type="file" id="input" multiple onchange="ab1ToJson(this.files[0])">
// or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
file,
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
)
//we always return an array of results because some files my contain multiple sequences
results[0].success //either true or false
results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
results[0].parsedSequence //this will be the generalized json format as specified above :)
//chromatogram data will be here (ab1 only):
results[0].parsedSequence.chromatogramData snapgeneToJson (.dna files)
import { snapgeneToJson } from "bio-parsers"
//file can be either a browser file <input type="file" id="input" multiple onchange="snapgeneToJson(this.files[0])">
// or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
const results = await snapgeneToJson(file,options)genbankToJson
import { genbankToJson } from "bio-parsers"
const result = genbankToJson(string, options)
console.info(result)
// [
// {
// "messages": [
// "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
// "Invalid feature end: 1384 detected for Homo sapiens and set to 1",
// ],
// "success": true,
// "parsedSequence": {
// "features": [
// {
// "notes": {
// "organism": [
// "Homo sapiens"
// ],
// "db_xref": [
// "taxon:9606"
// ],
// "chromosome": [
// "17"
// ],
// "map": [
// "17q21"
// ]
// },
// "type": "source",
// "strand": 1,
// "name": "Homo sapiens",
// "start": 0,
// "end": 1
// }
// ],
// "name": "NP_003623",
// "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
// "circular": true,
// "extraLines": [
// "DEFINITION contactin-associated protein 1 precursor [Homo sapiens].",
// "ACCESSION NP_003623",
// "VERSION NP_003623.1 GI:4505463",
// "DBSOURCE REFSEQ: accession NM_003632.2",
// "KEYWORDS RefSeq."
// ],
// "type": "DNA",
// "size": 925
// }
// }
// ]You can see more examples by looking at the tests.
Editing This Repo
All collaborators:
Edit/create a new file and update/add any relevant tests.
Make sure they pass by running yarn test
Debug
yarn test-debugUpdating this repo
Teselagen collaborators
Commit and push all changes Sign into npm using the teselagen npm account (npm whoami)
npm version patch|minor|major
npm publishOutside collaborators
fork and pull request please :)
Thanks/Collaborators
- IsaacLuo - https://github.com/IsaacLuo/SnapGeneFileReader (from which the snapgene parser was adapted)
- Joshua Nixon (original collaborator)
- Thomas Rich (original collaborator)
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
3 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
4 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
5 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
6 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
7 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
8 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
9 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
10 years ago
11 years ago