bionode-fasta v0.5.0
Install
Install bionode-fasta with npm:
$ npm install bionode-fastaTo use it as a command line tool, you can install it globally by adding -g .
Alternatively, just include bionode-fasta.min.js via a <script/> in your page.
Usage
If you are using bionode-fasta with Node.js, you can require the module:
var fasta = require('bionode-fasta')
fasta('./input.fasta').pipe(process.stdout) // Returns Buffers
fasta.obj('./input.fasta').on('data', console.log) // Returns Objects
fs.createReadStream('./input.fasta').pipe(fasta()) // Parses streamed content
fs.createReadStream('./fasta-list.txt')
.pipe(split())
.pipe(fasta({filenameMode: true})) // Parses files from filename Strings
=> { id: 'sequence1',
seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
{ id: 'sequence2',
seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }
fasta.obj({includePath: true}, './input.fasta').on('data', console.log) // Returns Objects
=> { id: 'sequence1',
seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC'
path: './input.fasta' }Please read the documentation for the methods exposed by bionode-fasta.
Command line example
$ bionode-fasta input.fasta output.jsonContributing
To contribute, clone this repo locally and commit your code on a separate branch.
Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:
$ npm testPlease also check for code coverage:
$ npm run coverageTo rebuild and minify the module for the browser:
$ npm run build-browserTo rebuild the documentation using the comments in the code:
$ npm run build-docsCheck the issues for ways to contribute.
Contacts
Bruno Vieira [mail@bmpvieira.com](mailto:mail@bmpvieira.com) @bmpvieira
License
bionode-fasta is licensed under the MIT license.
Check ChooseALicense.com for details.
